Stem-loop sequence aga-mir-970

AccessionMI0010599 (change log)
DescriptionAnopheles gambiae miR-970 stem loop
Gene family MIPF0000700; mir-970
Literature search

1 open access papers mention aga-mir-970
(1 sentences)

Stem-loop
   -au  c  a            a    u        ---u    a   ua u 
5'    gg ug cggaagauagcc gcgu uguuuuau    uggu ugu  c a
      || || |||||||||||| |||| ||||||||    |||| |||  |  
3'    cc ac gccuuuuaucgg cgca acagaaua    aucg acg  g c
   agc  a  -            -    c        cuau    a   uc u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chrX: 112022-112119 [-]
intergenic
Database links

Mature sequence aga-miR-970

Accession MIMAT0010105
Sequence

64 - 

ucauaagacacacgcggcuau

 - 84

Get sequence
Evidence by similarity; MI0005827

References

1
" Griffiths-Jones S Unpublished (2009).