Stem-loop sequence aga-mir-263b

AccessionMI0010606 (change log)
DescriptionAnopheles gambiae miR-263b stem loop
Gene family MIPF0000122; mir-263
Literature search

1 open access papers mention aga-mir-263b
(1 sentences)

Stem-loop
   -ug     uua     cu      ug     a       uggau  uac 
5'    accaa   uggac  uggcac  ggaga uucacag     cg   c
      |||||   |||||  ||||||  ||||| |||||||     ||    
3'    ugguu   acuug  accgug  uuucu agguguc     gc   a
   ccg     uag     cu      cu     -       --uuu  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chr2L: 17784444-17784539 [+]
intergenic
Database links

Mature sequence aga-miR-263b

Accession MIMAT0010111
Sequence

16 - 

cuuggcacugggagaauucac

 - 36

Get sequence
Evidence by similarity; MI0000383

References

1
" Griffiths-Jones S Unpublished (2009).