miRBase entry: ebv-mir-BART22

Stem-loop ebv-mir-BART22


Accession
MI0010628
Description
Epstein Barr virus ebv-mir-BART22 precursor miRNA

Literature search
6 open access papers mention ebv-mir-BART22
(16 sentences)

Sequence


gucacaggugcuagacccuggaguugaaccaguaccacucggUUACAAAGUCAUGGUCUAGUAGUugugac
(((((((.(((((((((.(((..((((((((((...))).)))).)))..))).))))))))).)))))))

Structure
       g         c   ag   -    -   a 
gucacag ugcuagacc ugg  uug aacc agu  
||||||| ||||||||| |||  ||| |||| ||| c
caguguU AUGAUCUGG ACU  AAC UUgg uca  
       G         U   GA   A    c   c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
HHV507799: 147161-147231 [+]
Clustered miRNAs
21 other miRNAs are < 10 kb from ebv-mir-BART22
Name Accession Chromosome Start End Strand Confidence




Disease association
ebv-mir-BART22 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature ebv-miR-BART22-3p

Accession MIMAT0010132
Description Epstein Barr virus ebv-miR-BART22-3p mature miRNA
Sequence 43 - UUACAAAGUCAUGGUCUAGUAGU - 65
Evidence experimental
RT-PCR [1], 454 [2], cloned [3], Northern [3]

References

  1. PubMed ID: 19144710
    Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
    "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
    "J Virol (2009) 83:3333-3341

  2. PubMed ID: 19881953
    Modulation of LMP2A expression by a newly identified Epstein-Barr virus-encoded microRNA miR-BART22
    "Lung RW, Tong JH, Sung YM, Leung PS, Ng DC, Chau SL, Chan AW, Ng EK, Lo KW, To KF"
    "Neoplasia (2009) 11:1174-1184

  3. PubMed ID: 19091858
    Comprehensive profiling of Epstein-Barr virus microRNAs in nasopharyngeal carcinoma
    "Cosmopoulos K, Pegtel M, Hawkins J, Moffett H, Novina C, Middeldorp J, Thorley-Lawson DA"
    "J Virol (2009) 83:2357-2367