Stem-loop sequence lmi-mir-10

Accession MI0010644
Description Locusta migratoria miR-10 stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-u   -  g    u           ug    
  acc cu uaga ccgaauuuguu  aca 
  ||| || |||| |||||||||||  || u
  ugg ga aucu ggcuuaaacag  uga 
uu   a  g    u           cg    
Get sequence

Mature sequence lmi-miR-10-5p

Accession MIMAT0010144
Previous IDs lmi-miR-10
Sequence

1 - 

uacccuguagauccgaauuugu

 - 22

Get sequence
Evidence experimental; Solexa [1]

Mature sequence lmi-miR-10-3p

Accession MIMAT0010145
Previous IDs lmi-miR-10*
Sequence

38 - 

aaauucgguucuagagagguuu

 - 59

Get sequence
Evidence experimental; Solexa [1]

References

1