Stem-loop sequence bol-MIR172a

Accession MI0010665
Description Brassica oleracea miR172a stem-loop
Gene family MIPF0000035; MIR172
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-172_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-172 microRNA is thought to target mRNAs coding for APETALA2-like transcription factors. It has been verified experimentally in the model plant, Arabidopsis thaliana (mouse-ear cress). The mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
    uu    a gc      c           a    gaa  uga     cu      u 
cguu  uugu g  gcagca caucaagauuc caug   au   aaaau  ccuaau u
||||  |||| |  |||||| ||||||||||| ||||   ||   |||||  |||||| u
gcag  aaca c  cgucgu guaguucuaag guau   ua   uuuug  ggauua u
    cc    a ua      a           a    aug  uag     --      a
Get sequence

Mature sequence bol-miR172a

Accession MIMAT0010171
Sequence

87 -  

agaaucuugaugaugcugcau

 - 107

Get sequence
Evidence by similarity; MI0010661

References

1
PMID:18558089 "Characterization of conserved and novel microRNAs and their targets, including a TuMV-induced TIR-NBS-LRR class R gene-derived novel miRNA in Brassica" He XF, Fang YY, Feng L, Guo HS FEBS Lett. 582:2445-2452(2008).