Stem-loop sequence sja-let-7

AccessionMI0010668 (change log)
DescriptionSchistosoma japonicum let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

14 open access papers mention sja-let-7
(52 sentences)

Stem-loop 
   u    -- g     c            g    uuaaa 
5'  ggga  g uaguu guugugugguuu cuua     a
    ||||  | ||||| |||||||||||| ||||      
3'  cccu  c gucag caacauaccaga gaau     u
   a    uu g     c            a    ucuag
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01067189.1: 5854-5927 [+]
intergenic
Database links

Mature sequence sja-let-7

Accession MIMAT0010175
Sequence

3 -  

ggagguaguucguuguguggu

 - 23

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).
2
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).