![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sja-let-7 |
|||||
Accession | MI0010668 (change log) | ||||
Description | Schistosoma japonicum let-7 stem-loop | ||||
Gene family | MIPF0000002; let-7 | ||||
Literature search |
![]()
14 open access papers mention sja-let-7 | ||||
Stem-loop |
u -- g c g uuaaa 5' ggga g uaguu guugugugguuu cuua a |||| | ||||| |||||||||||| |||| 3' cccu c gucag caacauaccaga gaau u a uu g c a ucuag |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sja-let-7 |
|
Accession | MIMAT0010175 |
Sequence |
3 - ggagguaguucguuguguggu - 23 |
Evidence | experimental; cloned [1], Illumina [2] |
References |
|
1 |
PMID:19107204
"Identification and characterization of novel microRNAs from Schistosoma japonicum"
PLoS One. 3:e4034(2008).
|
2 |
PMID:20161724
"An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum"
PLoS Negl Trop Dis. 4:e596(2010).
|