miRBase
|
|
miRBase |
|
|
||
Stem-loop sequence sja-mir-71a |
||||||||||
| Accession | MI0010669 (change log) | |||||||||
| Previous IDs | sja-mir-71 | |||||||||
| Description | Schistosoma japonicum miR-71 stem-loop | |||||||||
| Gene family | MIPF0000278; mir-71 | |||||||||
| Literature search |
![](javascript:TINY.box.show( {html:'<img style="padding:20px;" width=460 src="/images/wordcloud/00/10/66/MI0010669.png">', width:500,height:500, mask:true, opacity:5, close:true} ))
16 open access papers mention sja-mir-71a | |||||||||
| Stem-loop |
a ag u a au u c 5' gugau cu ugcug gaaag cg gg agugagaugc a ||||| || ||||| ||||| || || |||||||||| g 3' cacua ga auggc cuuuc gc cc ucgcucuacg u a -- c c -c u u |
|||||||||
| Confidence |
Annotation confidence: not enough data
| |||||||||
| Genome context |
|
|||||||||
| Clustered miRNAs |
|
|||||||||
| Database links |
|
|||||||||
Mature sequence sja-miR-71a |
|
| Accession | MIMAT0010176 |
| Previous IDs | sja-miR-71 |
| Sequence |
16 - ugaaagacgaugguagugaga - 36 |
| Evidence | experimental; cloned [1], Illumina [2] |
References |
|
| 1 |
PMID:19107204
"Identification and characterization of novel microRNAs from Schistosoma japonicum"
PLoS One. 3:e4034(2008).
|
| 2 |
PMID:20161724
"An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum"
PLoS Negl Trop Dis. 4:e596(2010).
|