![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sja-mir-71a |
||||||||||
Accession | MI0010669 (change log) | |||||||||
Previous IDs | sja-mir-71 | |||||||||
Description | Schistosoma japonicum miR-71 stem-loop | |||||||||
Gene family | MIPF0000278; mir-71 | |||||||||
Literature search |
![]()
16 open access papers mention sja-mir-71a | |||||||||
Stem-loop |
a ag u a au u c 5' gugau cu ugcug gaaag cg gg agugagaugc a ||||| || ||||| ||||| || || |||||||||| g 3' cacua ga auggc cuuuc gc cc ucgcucuacg u a -- c c -c u u |
|||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence sja-miR-71a |
|
Accession | MIMAT0010176 |
Previous IDs | sja-miR-71 |
Sequence |
16 - ugaaagacgaugguagugaga - 36 |
Evidence | experimental; cloned [1], Illumina [2] |
References |
|
1 |
PMID:19107204
"Identification and characterization of novel microRNAs from Schistosoma japonicum"
PLoS One. 3:e4034(2008).
|
2 |
PMID:20161724
"An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum"
PLoS Negl Trop Dis. 4:e596(2010).
|