Stem-loop sequence sja-bantam

AccessionMI0010670 (change log)
DescriptionSchistosoma japonicum bantam stem-loop
Gene family MIPF0000153; bantam
Literature search

15 open access papers mention sja-bantam
(144 sentences)

Stem-loop
     gu       u      c   g   --------    c   u 
5' aa  cggcuuu auugcg ucu aga        aaaa caa u
   ||  ||||||| |||||| ||| |||        |||| |||  
3' uu  gucgaaa uagcgc aga ucu        uuuu guu c
     ug       u      u   g   auuuauuu    c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sja-bantam

Accession MIMAT0010177
Sequence

57 - 

ugagaucgcgauuaaagcuggu

 - 78

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).
2
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).