Stem-loop sequence sja-mir-125a

AccessionMI0010671 (change log)
DescriptionSchistosoma japonicum miR-125a stem-loop
Gene family MIPF0000733; mir-125_2
Literature search

8 open access papers mention sja-mir-125a
(28 sentences)

Stem-loop 
     u -      a c     au     -----    a      au 
5' gc c ccugag c cuuug  ugucu     cguu aacaua  u
   || | |||||| | |||||  |||||     |||| ||||||   
3' cg g ggacuc g gaaac  acgga     guaa uuguau  c
     u u      a u     cg     cuaau    a      au
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01024723.1: 7689-7772 [+]
intergenic
Database links

Mature sequence sja-miR-125a

Accession MIMAT0010178
Sequence

3 -  

ucccugagacccuuugauuguc

 - 24

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).
2
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).