![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sja-mir-125a |
|||||
Accession | MI0010671 (change log) | ||||
Description | Schistosoma japonicum miR-125a stem-loop | ||||
Gene family | MIPF0000733; mir-125_2 | ||||
Literature search |
![]()
8 open access papers mention sja-mir-125a | ||||
Stem-loop |
u - a c au ----- a au 5' gc c ccugag c cuuug ugucu cguu aacaua u || | |||||| | ||||| ||||| |||| |||||| 3' cg g ggacuc g gaaac acgga guaa uuguau c u u a u cg cuaau a au |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sja-miR-125a |
|
Accession | MIMAT0010178 |
Sequence |
3 - ucccugagacccuuugauuguc - 24 |
Evidence | experimental; cloned [1], Illumina [2] |
References |
|
1 |
PMID:19107204
"Identification and characterization of novel microRNAs from Schistosoma japonicum"
PLoS One. 3:e4034(2008).
|
2 |
PMID:20161724
"An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum"
PLoS Negl Trop Dis. 4:e596(2010).
|