Stem-loop sequence sja-mir-125b

AccessionMI0010672 (change log)
DescriptionSchistosoma japonicum miR-125b stem-loop
Gene family MIPF0000033; mir-10
Literature search

8 open access papers mention sja-mir-125b
(27 sentences)

Stem-loop
   auc       c             a   auuaua   u 
5'    ccugaga ugauaauugcucu guu      uca u
      ||||||| ||||||||||||| |||      |||  
3'    ggacucu auuauuaacggga uaa      agu a
   ugu       u             a   cauuug   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01027351.1: 4363-4440 [-]
intergenic
Database links

Mature sequence sja-miR-125b

Accession MIMAT0010179
Sequence

2 - 

ucccugagacugauaauugcuc

 - 23

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).
2
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).