Stem-loop sequence sma-mir-71a

Accession

MI0010674 (change log)

Previous IDs

sma-mir-71

Description

Schistosoma mansoni miR-71 stem-loop

Gene family

MIPF0000278; mir-71

Literature search

8 open access papers mention sma-mir-71a
(30 sentences)

Stem-loop

   u     a  ag     u     a  au  u          c 
5'  gugau cu  ugcug gaaag cg  gg agugagaugc g
    ||||| ||  ||||| ||||| ||  || |||||||||| a
3'  cacua ga  auggc cuuuc gc  cc ucgcucuacg u
   g     a  --     c     c  -c  u          u 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (WTSI5): Chr_W: 22875654-22875735 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from sma-mir-71a

• sma-mir-71a: Chr_W: 22875654-22875735 [+]
• sma-mir-2a: Chr_W: 22875749-22875826 [+]
• sma-mir-2b: Chr_W: 22875844-22875922 [+]
• sma-mir-2e: Chr_W: 22875945-22876027 [+]

Database links

• miRBase Tracker:MI0010674

Mature sequence sma-miR-71a-5p

• Accession: MIMAT0010181
• Previous IDs: sma-miR-71a
• Sequence: 17 - ugaaagacgaugguagugaga - 37
• Evidence: experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-71a-3p

• Accession: MIMAT0032103
• Sequence: 49 - ucucgcuuccccgccuuucccg - 70
• Evidence: experimental; Illumina [2], SOLiD [2]

References

1. PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).
2. PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).