Stem-loop sequence sma-mir-71a

AccessionMI0010674 (change log)
Previous IDssma-mir-71
DescriptionSchistosoma mansoni miR-71 stem-loop
Gene family MIPF0000278; mir-71
Literature search

8 open access papers mention sma-mir-71a
(30 sentences)

Stem-loop
   u     a  ag     u     a  au  u          c 
5'  gugau cu  ugcug gaaag cg  gg agugagaugc g
    ||||| ||  ||||| ||||| ||  || |||||||||| a
3'  cacua ga  auggc cuuuc gc  cc ucgcucuacg u
   g     a  --     c     c  -c  u          u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_W: 22875654-22875735 [+]
intergenic
Clustered miRNAs
< 10kb from sma-mir-71a
sma-mir-71aChr_W: 22875654-22875735 [+]
sma-mir-2aChr_W: 22875749-22875826 [+]
sma-mir-2bChr_W: 22875844-22875922 [+]
sma-mir-2eChr_W: 22875945-22876027 [+]
Database links

Mature sequence sma-miR-71a-5p

Accession MIMAT0010181
Previous IDssma-miR-71a
Sequence

17 - 

ugaaagacgaugguagugaga

 - 37

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-71a-3p

Accession MIMAT0032103
Sequence

49 - 

ucucgcuuccccgccuuucccg

 - 70

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).