![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sma-mir-71a |
||||||||||
Accession | MI0010674 (change log) | |||||||||
Previous IDs | sma-mir-71 | |||||||||
Description | Schistosoma mansoni miR-71 stem-loop | |||||||||
Gene family | MIPF0000278; mir-71 | |||||||||
Literature search |
![]()
8 open access papers mention sma-mir-71a | |||||||||
Stem-loop |
u a ag u a au u c 5' gugau cu ugcug gaaag cg gg agugagaugc g ||||| || ||||| ||||| || || |||||||||| a 3' cacua ga auggc cuuuc gc cc ucgcucuacg u g a -- c c -c u u |
|||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence sma-miR-71a-5p |
|
Accession | MIMAT0010181 |
Previous IDs | sma-miR-71a |
Sequence |
17 - ugaaagacgaugguagugaga - 37 |
Evidence | experimental; Illumina [2], SOLiD [2] |
Mature sequence sma-miR-71a-3p |
|
Accession | MIMAT0032103 |
Sequence |
49 - ucucgcuuccccgccuuucccg - 70 |
Evidence | experimental; Illumina [2], SOLiD [2] |
References |
|
1 |
PMID:19107204
"Identification and characterization of novel microRNAs from Schistosoma japonicum"
PLoS One. 3:e4034(2008).
|
2 |
PMID:24069470
"Sex-biased expression of microRNAs in Schistosoma mansoni"
PLoS Negl Trop Dis. 7:e2402(2013).
|