Stem-loop sequence sma-bantam

AccessionMI0010675 (change log)
DescriptionSchistosoma mansoni bantam stem-loop
Literature search

8 open access papers mention sma-bantam
(45 sentences)

Stem-loop
   -  c  gu       u      c   g   aa  u 
5'  gg aa  cggcuuu auugcg ucu aga  au u
    || ||  ||||||| |||||| ||| |||  || a
3'  cc uu  gucgaaa uagcgc aga ucu  ug u
   a  u  ug       u      u   g   ac  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
SC_0137: 369443-369514 [+]
intergenic
Database links

Mature sequence sma-bantam-5p

Accession MIMAT0032104
Sequence

8 - 

cggcuuuuauugcgcucugaga

 - 29

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-bantam-3p

Accession MIMAT0010182
Previous IDssma-bantam
Sequence

45 - 

ugagaucgcgauuaaagcuggu

 - 66

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).