Stem-loop sequence hsv2-mir-H3

AccessionMI0010692 (change log)
DescriptionHerpes Simplex Virus 2 miR-H3 stem-loop
Gene family MIPF0000717; mir-H3
Stem-loop 
      ga -ga    g  -                   -         c  acg 
5' agc  g   cgcg cc ggcgcgcucucgaccgcgg uucccgagu gu   c
   |||  |   |||| || ||||||||||||||||||| ||||||||| ||    
3' ucg  c   gcgc gg ccgcgcgaggguuggcguc gaggguuua ca   a
      -g acg    g  g                   u         c  ggg
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named miR-I in [1], but is a clear homolog of miR-H3 in HSV-1.

Database links

Mature sequence hsv2-miR-H3

Accession MIMAT0010202
Sequence

59 -  

uuugggagucugcgguugggag

 - 80

Get sequence
Evidence experimental; 454 [1], Illumina [2-3]

References

1
PMID:19019961 "Novel less-abundant viral microRNAs encoded by herpes simplex virus 2 latency-associated transcript and their roles in regulating ICP34.5 and ICP0 mRNAs" Tang S, Patel A, Krause PR J Virol. 83:1433-1442(2009).
2
PMID:19889786 "Identification of viral microRNAs expressed in human sacral ganglia latently infected with herpes simplex virus 2" Umbach JL, Wang K, Tang S, Krause PR, Mont EK, Cohen JI, Cullen BR J Virol. 84:1189-1192(2010).
3
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).