Stem-loop sequence hsv2-mir-H4

AccessionMI0010693 (change log)
DescriptionHerpes Simplex Virus 2 miR-H4 stem-loop
Gene family MIPF0001247; mir-H4
Stem-loop
           a      a  c    c     c  --   u 
5' ggggcggg gaguuc cu ggca gcaug ac  gug a
   |||||||| |||||| || |||| ||||| ||  |||  
3' cccugccc cucaag ga ccgu cgugc ug  cgc a
           a      c  u    u     c  ac   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named miR-II in [1], but is a clear homolog of miR-H4 in HSV-1.

Database links

Mature sequence hsv2-miR-H4-5p

Accession MIMAT0010203
Sequence

10 - 

gaguucacucggcacgcaugc

 - 30

Get sequence
Evidence experimental; 454 [1], Illumina [2-3]

Mature sequence hsv2-miR-H4-3p

Accession MIMAT0010204
Sequence

47 - 

ccgugcuugccuagcgaacuc

 - 67

Get sequence
Evidence experimental; 454 [1], Illumina [2-3]

References

1
2
PMID:19889786 "Identification of viral microRNAs expressed in human sacral ganglia latently infected with herpes simplex virus 2" Umbach JL, Wang K, Tang S, Krause PR, Mont EK, Cohen JI, Cullen BR J Virol. 84:1189-1192(2010).
3
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).