Stem-loop sequence gma-MIR2119

AccessionMI0010697 (change log)
DescriptionGlycine max miR2119 stem-loop
Gene family MIPF0000762; MIR2119
Literature search

5 open access papers mention gma-MIR2119
(15 sentences)

Stem-loop
       u          u     aauu         c   a    u           -       uagaaa 
5' auac ucauuuuuua acuuu    uccucuaua cuc cuuu auuggagaaaa aagagaa      a
   |||| |||||||||| |||||    ||||||||| ||| |||| ||||||||||| |||||||      u
3' ugug gguaaaagau ugaaa    aggggaugu gag gaaa uaacuuuuuuu uucucuu      a
       c          u     ----         u   g    c           c       uaggug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 7214478-7214613 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR2119
gma-MIR398achr1: 7214749-7214864 [-]
gma-MIR2119chr1: 7214478-7214613 [-]
Database links

Mature sequence gma-miR2119

Accession MIMAT0011167
Sequence

96 - 

ucaaagggaguuguaggggaa

 - 116

Get sequence
Evidence not experimental

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).