Stem-loop sequence mtr-MIR2119

Accession MI0010698
Description Medicago truncatula miR2119 stem-loop
Gene family MIPF0000762; MIR2119
Stem-loop 
uuuauu           aaga      c                 aa    ag     -caa   gg 
      uuuuuuacacu    uacucc uacuuuccuuugauugg  auaa  agaga    aaa  u
      |||||||||||    |||||| |||||||||||||||||  ||||  |||||    |||   
      gaaaaaugugg    augagg guggagggaaacuaacu  uauu  ucucu    uuu  a
--aaau           ---g      u                 -g    cu     uuaa   aa
Get sequence

Mature sequence mtr-miR2119

Accession MIMAT0011168
Sequence

94 -  

ucaaagggagguguggaguag

 - 114

Get sequence
Evidence experimental; 454 [2-3], Northern [2]
Validated targets

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).
3
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).