![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mtr-MIR2119 |
||||||
Accession | MI0010698 (change log) | |||||
Description | Medicago truncatula miR2119 stem-loop | |||||
Gene family | MIPF0000762; MIR2119 | |||||
Stem-loop |
uuuauu aaga c aa ag -caa gg 5' uuuuuuacacu uacucc uacuuuccuuugauugg auaa agaga aaa u ||||||||||| |||||| ||||||||||||||||| |||| ||||| ||| 3' gaaaaaugugg augagg guggagggaaacuaacu uauu ucucu uuu a --aaau --ag u -g cu uuaa aa |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mtr-miR2119 |
|
Accession | MIMAT0011168 |
Sequence |
94 - ucaaagggagguguggaguag - 114 |
Evidence | experimental; 454 [2-3], Northern [2] |
References |
|
1 |
PMID:19353277
"Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress"
Plant Mol Biol. 70:385-401(2009).
|
2 |
PMID:19555436
"Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families"
New Phytol. 184:85-98(2009).
|
3 |
PMID:19767456
"Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules"
Plant Cell. 21:2780-2796(2009).
|