Stem-loop sequence pvu-MIR166a

Accession

MI0010704

Description

Phaseolus vulgaris miR166a stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

aucaguuucuacuuucuaaucaucaacuucuucaaacacaucauaugaauauagcuaccuaggugcuguuuucuuuuccaacuuccucauaucuuguucauuccuugcaaaggugagguugagaggaauguugucuggcucgaggucauggaggaggagaguucucagauaaacucuuucacccaaaguuuccaauggaaauuuacccucuaacaccaaaauga      gacca    uca    ccc   ccaa     g  -a         --    -aa    -       u   --   ccccaugcuuguuuuugcaggaucagaauuuucaacucacuacccaucuucuuuuguuuuaccuguaaauaucuuuauaaaggccggugaaaauuauagggaaggcaacuucauaau 
                                                                                                                                                                                                                                uucucg     ggcu   uucc   cac    cuuuu cu  uuuucuuuc  ucgu   ucuu cauauuu gca  ugc                                                                                                                     u
                                                                                                                                                                                                                                ||||||     ||||   ||||   |||    ||||| ||  |||||||||  ||||   |||| ||||||| |||  |||                                                                                                                      
                                                                                                                                                                                                                                aagagc     uuga   aagg   gug    gaaga ga  agaagaaag  agua   agaa guguaaa cgu  acg                                                                                                                     u
------------------------------------------------------------------------------------------------------------------------------------------------------------------uucucagugucugagucuguguaucuuagggaucgaacgaucgaagaggacuaagagugaag      ---aa    --c    -uc   aaga     -  ag         ua    aug    a       u   au   aagagucguugaaagucgccgaucacucacguacggaaguugugagcagugacaguaaagugacuucauguaaguaagucuacaacuacuuuuacuaccguucggaaaaaggguuca 

Mature sequence pvu-miR166a

• Accession: MIMAT0011175
• Sequence: 228 - ucggaccaggcuucauucccc - 248
• Evidence: experimental; cloned [1], Northern [1]

References

1. PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).