Stem-loop sequence pvu-MIR166a

AccessionMI0010704 (change log)
DescriptionPhaseolus vulgaris miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

3 open access papers mention pvu-MIR166a
(13 sentences)

Stem-loop
   -cuu        ga   u a a      uu      cu     -    ---------     aggagaguucucagauaaacucuuu 
5'     gcaaaggu  ggu g g ggaaug  gucugg  cgagg ucau         ggagg                         c
       ||||||||  ||| | | ||||||  ||||||  ||||| ||||         |||||                          
3'     cguuuuca  cca c c ccuuac  cggacc  gcucu agua         ucucc                         a
   uuau        ac   c - c      uu      ag     u    aaaccacaa     cauuuaaagguaaccuuugaaaccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PhaVulg1_0; GCA_000499845.1) Overlapping transcripts
chr2: 44066654-44066817 [-]
intergenic
Database links

Mature sequence pvu-miR166a

Accession MIMAT0011175
Sequence

125 - 

ucggaccaggcuucauucccc

 - 145

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).