Stem-loop sequence pvu-MIR399a

Accession

MI0010706

Description

Phaseolus vulgaris miR399a stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

-ugcacaagauauuauagucaauaa   a  c g  a   g          gu   c  ga     -    ac    ucaugaaauaucuugccaaaggagaguugcccugu 
                         gca ac a uu uag gcuucucuuu  ugg ag  aauga caug  cacu                                   u
                         ||| || | || ||| ||||||||||  ||| ||  ||||| ||||  ||||                                   g
                         cgu ug u aa guc cgaagagaag  acc uc  uuacu guau  guga                                   c
cuacuucaguaaacaaacuagggaa   a  a g  -   a          uu   -  ac     a    ac    cuuaucguaucuucuaauguauaauucgauuucgu 

Mature sequence pvu-miR399a

• Accession: MIMAT0011177
• Sequence: 89 - ugccaaaggagaguugcccug - 109
• Evidence: experimental; cloned [1], Northern [1]

References

1. PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).