Stem-loop sequence pvu-MIR399a

AccessionMI0010706 (change log)
DescriptionPhaseolus vulgaris miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

8 open access papers mention pvu-MIR399a
(38 sentences)

Stem-loop
   -----------------------------------------------------------------------------ugcacaagauauuauagucaa     -   c    u       uu     ug         a  ga     c 
5'                                                                                                   uaagc aaa cagu auagggc  cucuu  uuggcagga au  cauga c
                                                                                                     ||||| ||| |||| |||||||  |||||  ||||||||| ||  ||||| a
3'                                                                                                   auucg uuu gucg ugucccg  gagag  aaccguucu ua  guacu c
   cuacuucaguaaacaaacuagggaacguaugaugaagucacgaagagaaguuaccucacuuacuaguauacgugacuuaucguaucuucuaauguaua     a   c    u       uu     ga         a  aa     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PhaVulg1_0; GCA_000499845.1) Overlapping transcripts
chr7: 5883859-5884081 [-]
intergenic
Database links

Mature sequence pvu-miR399a

Accession MIMAT0011177
Sequence

89 - 

ugccaaaggagaguugcccug

 - 109

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).