Stem-loop sequence vun-MIR1507b

AccessionMI0010707 (change log)
DescriptionVigna unguiculata miR1507b stem-loop
Gene family MIPF0000699; MIR1507
Literature search

1 open access papers mention vun-MIR1507b
(1 sentences)

Stem-loop
     a ua    g    -                  a     aaacgccuuuc       
5' gu g  uuug caga gguguauggagugagaga gggaa           ccgauc 
   || |  |||| |||| |||||||||||||||||| |||||           ||||| u
3' cg u  aagc gucu cuacauaccuuacucucu ccuuu           ggcuac 
     a gc    a    g                  -     ----cuuucuu       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence vun-miR1507b

Accession MIMAT0011178
Sequence

78 - 

ucucauuccauacaucgucug

 - 98

Get sequence
Evidence by similarity; MI0007219

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).