miRBase entry: gma-MIR167e

Stem-loop gma-MIR167e


Accession
MI0010725
Description
Glycine max gma-MIR167e precursor miRNA
Gene family
MIPF0000023; MIR167_1

Literature search
26 open access papers mention gma-MIR167e
(208 sentences)

Sequence

ucaugcaccacuaccaguUGAAGCUGCCAGCAUGAUCUUaacuucccucacuugccguggaaagaucagaucauguggcaguuucaccuaguaguugcuggccgcauga
((((((.(((((((.((.(((((((((((.((((((((...(((...((((.....)))).)))...))))))))))))))))))).)).)))))....))..))))))

Structure
      -a  ----     c  u           G        Uaa   ccc    u 
ucaugc  cc    acuac ag UGAAGCUGCCA CAUGAUCU   cuu   ucac u
||||||  ||    ||||| || ||||||||||| ||||||||   |||   |||| g
aguacg  gg    ugaug uc acuuugacggu guacuaga   gaa   ggug c
      cc  ucgu     a  c           -        cua   --a    c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr20: 39002092-39002200 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from gma-MIR167e
Name Accession Chromosome Start End Strand Confidence




Database links

Mature gma-miR167e

Accession MIMAT0011196
Description Glycine max gma-miR167e mature miRNA
Sequence 19 - UGAAGCUGCCAGCAUGAUCUU - 39
Evidence experimental
cloned [1], Northern [1], Illumina [2], 454 [3]

References

  1. PubMed ID: 20122185
    Prediction of novel miRNAs and associated target genes in Glycine max
    Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
    BMC Bioinformatics (2010) 11:S14

  2. PubMed ID: 19084500
    Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules
    "Wang Y, Li P, Cao X, Wang X, Zhang A, Li X"
    "Biochem Biophys Res Commun (2009) 378:799-803

  3. PubMed ID: 21504877
    MicroRNAs in the shoot apical meristem of soybean
    "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
    "J Exp Bot (2011) 62:2495-2506