![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sme-mir-2148 |
||||||
Accession | MI0010764 (change log) | |||||
Description | Schmidtea mediterranea miR-2148 stem-loop | |||||
Stem-loop |
- u -aacca -uc c u ugau au 5' g aagu guuua agagaaauu ugugg cu uguaa g | |||| ||||| ||||||||| ||||| || ||||| 3' c uuca caaau uuucuuuaa acacc gg auauu a a - aguuug uau a c --uc au |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence sme-miR-2148-5p |
|
Accession | MIMAT0011224 |
Previous IDs | sme-miR-2148 |
Sequence |
21 - agaaauucuguggucuugauu - 41 |
Evidence | experimental; 454 [1], Illumina [1-2] |
Mature sequence sme-miR-2148-3p |
|
Accession | MIMAT0012131 |
Previous IDs | sme-miR-2148* |
Sequence |
54 - auacuggcccacaaaauuucuuu - 76 |
Evidence | experimental; 454 [1], Illumina [1-2] |
References |
|
1 |
PMID:19564616
"High-resolution profiling and discovery of planarian small RNAs"
Proc Natl Acad Sci U S A. 106:11546-11551(2009).
|
2 |
PMID:19553344
"Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea"
RNA. 15:1483-1491(2009).
|