Stem-loop sequence sme-mir-2148

AccessionMI0010764 (change log)
DescriptionSchmidtea mediterranea miR-2148 stem-loop
Stem-loop
   - u    -aacca     -uc         c     u  ugau     au 
5'  g aagu      guuua   agagaaauu ugugg cu    uguaa  g
    | ||||      |||||   ||||||||| ||||| ||    |||||   
3'  c uuca      caaau   uuucuuuaa acacc gg    auauu  a
   a -    aguuug     uau         a     c  --uc     au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig12516: 6907-7002 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-2148
sme-mir-2148Contig12516: 6907-7002 [-]
sme-mir-2177Contig12516: 6806-6901 [-]
Database links

Mature sequence sme-miR-2148-5p

Accession MIMAT0011224
Previous IDssme-miR-2148
Sequence

21 - 

agaaauucuguggucuugauu

 - 41

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2148-3p

Accession MIMAT0012131
Previous IDssme-miR-2148*
Sequence

54 - 

auacuggcccacaaaauuucuuu

 - 76

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).