Stem-loop sequence sme-mir-753b

AccessionMI0010766 (change log)
DescriptionSchmidtea mediterranea miR-753b stem-loop
Gene family MIPF0000752; mir-753
Stem-loop
   --uuuuuau    cauau      -        u           u 
5'          aaag     uuuaag gcuugaau gugaucucaua a
            ||||     |||||| |||||||| |||||||||||  
3'          uuuc     aaauuc cgaacuug uacuagaguau u
   guuacuacu    auaau      u        u           u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig7065: 2454-2544 [+]
intergenic
Database links

Mature sequence sme-miR-753b-5p

Accession MIMAT0011395
Sequence

21 - 

aggcuugaauugugaucuca

 - 40

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

Mature sequence sme-miR-753b-3p

Accession MIMAT0011226
Sequence

49 - 

ugagaucauuguucaagcucuua

 - 71

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).