Stem-loop sequence sme-mir-61b

AccessionMI0010767 (change log)
DescriptionSchmidtea mediterranea miR-61b stem-loop
Stem-loop
   ----caaa    cg   ac  a     uc   -u        a       g 
5'         gcgg  auu  ac gaaga  gug  cguucuag uuacaug a
           ||||  |||  || |||||  |||  |||||||| |||||||  
3'         cgcc  uaa  ug uuucu  cac  guaagauc aguguau u
   ucuacuag    --   ga  a     uc   uu        -       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig3451: 4512-4607 [+]
intergenic
Database links

Mature sequence sme-miR-61b-5p

Accession MIMAT0012132
Sequence

20 - 

aagaucgugucguucuagauua

 - 41

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-61b-3p

Accession MIMAT0011227
Sequence

54 - 

ugacuagaauguucaccuucuuu

 - 76

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).