Stem-loop sequence sme-mir-87c

AccessionMI0010768 (change log)
DescriptionSchmidtea mediterranea miR-87c stem-loop
Stem-loop
   ----guucuc   u    uc c              gg  cc  gc     c 
5'           ggc cgug  g agucaauugauaau  gc  ca  cauuc a
             ||| ||||  | ||||||||||||||  ||  ||  ||||| g
3'           ccg guac  u ucaguuaacuauua  cg  gu  guaag g
   ucuacuguua   -    cu -              aa  -a  -a     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig2469: 10412-10510 [+]
intergenic
Database links

Mature sequence sme-miR-87c-5p

Accession MIMAT0012133
Previous IDssme-miR-87c*
Sequence

20 - 

gucaauugauaaugggcccca

 - 40

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-87c-3p

Accession MIMAT0011228
Previous IDssme-miR-87c
Sequence

58 - 

augagcaaauuaucaauugacu

 - 79

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).