Stem-loop sequence sme-mir-754c-1

AccessionMI0010777 (change log)
DescriptionSchmidtea mediterranea miR-754c-1 stem-loop
Gene family MIPF0000749; mir-754
Stem-loop
   --auuuguca      - a c           -    uu        u 
5'           uccacc c g auguugcuugg ggua  acuauauu a
             |||||| | | ||||||||||| ||||  ||||||||  
3'           aggugg g c uauaacgaacu cuau  ugauauaa u
   acaacuuaua      a g -           u    uu        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig329: 118321-118413 [-]
intergenic
Database links

Mature sequence sme-miR-754c-5p

Accession MIMAT0011237
Previous IDssme-miR-754c
Sequence

21 - 

guugcuugggguauuacuau

 - 40

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

Mature sequence sme-miR-754c-1-3p

Accession MIMAT0011414
Previous IDssme-miR-754c-1*
Sequence

55 - 

uuuuaucuucaagcaauaucgg

 - 76

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).