Stem-loop sequence sme-mir-124e

AccessionMI0010779 (change log)
DescriptionSchmidtea mediterranea miR-124e stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention sme-mir-124e
(6 sentences)

Stem-loop
   -----uuc      uu     ac  c     u    u ga         u 
5'         aauaaa  auucu  ug cauuc cagu g  gucuugaua g
           ||||||  |||||  || ||||| |||| |  ||||||||| a
3'         uuauuu  uaagg  ac guaag gucg c  cggaauuau u
   ucuucucu      --     -a  c     u    - -a         c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig2459: 516-608 [-]
intergenic
Database links

Mature sequence sme-miR-124e-5p

Accession MIMAT0012138
Previous IDssme-miR-124e*
Sequence

20 - 

gccauucucaguuggagucuu

 - 40

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-124e-3p

Accession MIMAT0011239
Previous IDssme-miR-124e
Sequence

53 - 

uaaggcacgcugugaaugcca

 - 73

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).