Stem-loop sequence sme-mir-8b

AccessionMI0010780 (change log)
DescriptionSchmidtea mediterranea miR-8b stem-loop
Stem-loop
   -ugcauuc         a  -ugc                ag      a 
5'         auucuaaua uu    uucuuacuugauggua  agacag u
           ||||||||| ||    ||||||||||||||||  ||||||  
3'         uaagauuau ag    aagaauggacugucau  uuuguu u
   gcuucuau         c  ucau                aa      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig2498: 379-476 [+]
intergenic
Database links

Mature sequence sme-miR-8b-5p

Accession MIMAT0012139
Previous IDssme-miR-8b*
Sequence

21 - 

gcuucuuacuugaugguaagaga

 - 43

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence sme-miR-8b-3p

Accession MIMAT0011240
Previous IDssme-miR-8b
Sequence

56 - 

uaauacugucagguaagaauacu

 - 78

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).