Stem-loop sequence sme-mir-1993

AccessionMI0010781 (change log)
DescriptionSchmidtea mediterranea miR-1993 stem-loop
Stem-loop
   ---uuaaccu  g   u      g      c          aa     guaca 
5'           uc aua guaauu augaau aacaguauaa  acgga     a
             || ||| |||||| |||||| ||||||||||  |||||      
3'           ag uau cauuga uacuua uugucguauu  ugcuu     c
   gcugcuauuu  g   -      g      -          -a     auaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1563: 42889-42990 [-]
intergenic
Database links

Mature sequence sme-miR-1993-5p

Accession MIMAT0012140
Previous IDssme-miR-1993*
Sequence

20 - 

ugaugaaucaacaguauaaaaacg

 - 43

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-1993-3p

Accession MIMAT0011241
Previous IDssme-miR-1993
Sequence

62 - 

uauuaugcuguuauucauga

 - 81

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).