Stem-loop sequence sme-mir-36b

AccessionMI0010782 (change log)
DescriptionSchmidtea mediterranea miR-36b stem-loop
Stem-loop
   uuuuuua    --       -cug          -       -     cuag 
5'        acag  ucuaacu    gauugauguu auucggu augau    a
          ||||  |||||||    |||||||||| ||||||| |||||    a
3'        uguc  agauuga    cuaauuacag ugggcca uauua    u
   -uccuga    ug       cgua          a       c     aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig20276: 572-672 [+]
intergenic
Contig21980: 6306-6406 [+]
intergenic
Clustered miRNAs
< 10kb from sme-mir-36b
sme-mir-36bContig20276: 572-672 [+]
sme-let-7bContig20276: 1039-1119 [+]
Database links

Mature sequence sme-miR-36b-5p

Accession MIMAT0012141
Previous IDssme-miR-36b*
Sequence

21 - 

ggauugauguuauucgguaugauc

 - 44

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence sme-miR-36b-3p

Accession MIMAT0011242
Previous IDssme-miR-36b
Sequence

59 - 

ucaccggguagacauuaaucaug

 - 81

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).