Stem-loop sequence sme-mir-1992

AccessionMI0010783 (change log)
DescriptionSchmidtea mediterranea miR-1992 stem-loop
Stem-loop
   ----uu        aag        --uu           u     gaa 
5'       augaaaua   aauuuguc    gaacaacugcu augau   a
         ||||||||   ||||||||    ||||||||||| |||||    
3'       uacuuuau   uugaacag    cuuguugacga uacug   a
   uauagu        --a        uuac           c     uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig11270: 11882-11973 [-]
intergenic
Database links

Mature sequence sme-miR-1992-5p

Accession MIMAT0012142
Sequence

17 - 

uugucuugaacaacugcuuau

 - 37

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-1992-3p

Accession MIMAT0011243
Sequence

53 - 

ucagcaguuguuccauugac

 - 72

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).