![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sme-mir-2154-1 |
|||||
Accession | MI0010784 (change log) | ||||
Description | Schmidtea mediterranea miR-2154-1 stem-loop | ||||
Gene family | MIPF0000781; mir-2154 | ||||
Stem-loop |
----uucg uauu uuc uu a a aau 5' agugau agaau agcuguacaa ggc uugugu ugaua g |||||| ||||| |||||||||| ||| |||||| ||||| 3' ucacua uuuua ucgauauguu cug aacaca auuau a ccaccuaa --uu uau -u - - aua |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sme-miR-2154-5p |
|
Accession | MIMAT0011244 |
Previous IDs | sme-miR-2154 |
Sequence |
21 - ucagcuguacaauuggcauugugu - 44 |
Evidence | experimental; Illumina [1-2], 454 [2] |
Mature sequence sme-miR-2154-3p |
|
Accession | MIMAT0011412 |
Previous IDs | sme-miR-2154* |
Sequence |
66 - acaagucuuuguauagcuuau - 86 |
Evidence | experimental; Illumina [1-2], 454 [2] |
References |
|
1 |
PMID:19564616
"High-resolution profiling and discovery of planarian small RNAs"
Proc Natl Acad Sci U S A. 106:11546-11551(2009).
|
2 |
PMID:19553344
"Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea"
RNA. 15:1483-1491(2009).
|