Stem-loop sequence sme-mir-216

AccessionMI0010785 (change log)
DescriptionSchmidtea mediterranea miR-216 stem-loop
Literature search

1 open access papers mention sme-mir-216
(2 sentences)

Stem-loop
   --ccuguc       ag    c    -    cc     a       --     a 
5'         augauuu  caag aauc ucag  uguua uaggagu  uugga a
           |||||||  |||| |||| ||||  ||||| |||||||  |||||  
3'         uacuaaa  guuc uuag aguc  gcaau auccuca  aauuu u
   aaccauuu       cu    a    u    -u     -       ua     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig23847: 7596-7698 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-216
sme-mir-216Contig23847: 7596-7698 [-]
sme-mir-2157Contig23847: 7335-7429 [-]
Database links

Mature sequence sme-miR-216-5p

Accession MIMAT0011245
Sequence

20 - 

caaucucagccuguuaauaggaguu

 - 44

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-216-3p

Accession MIMAT0012143
Sequence

61 - 

cuccuauaacgucugaugauuac

 - 83

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).