Stem-loop sequence sme-mir-2156a

AccessionMI0010786 (change log)
DescriptionSchmidtea mediterranea miR-2156a stem-loop
Stem-loop
   -uuuuuca    a      -ua        -u     a   c   aaua 
5'         aguc ugaaaa   aaaaguuu  ggguc uaa aua    a
           |||| ||||||   ||||||||  ||||| ||| |||    u
3'         uuag acuuuu   uuuucaaa  cccgg auu uau    u
   acgacauc    a      uac        uc     c   c   aauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1400: 30023-30120 [-]
intergenic
Database links

Mature sequence sme-miR-2156a-5p

Accession MIMAT0012144
Previous IDssme-miR-2156a*
Sequence

21 - 

aaaaguuuugggucauaacaua

 - 42

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2156a-3p

Accession MIMAT0011246
Previous IDssme-miR-2156a
Sequence

56 - 

ucuuacggccccuaaacuuuuca

 - 78

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).