Stem-loop sequence sme-mir-9b

AccessionMI0010787 (change log)
DescriptionSchmidtea mediterranea miR-9b stem-loop
Stem-loop
   ---acaaaug        a   uu          u   c       aug 
5'           ucaaauca gau  cuuugguugu uag uauauga   u
             |||||||| |||  |||||||||| ||| |||||||   c
3'           aguuuagu cug  gaaacuaaua guc auauacu   u
   ccuucgaaug        -   uu          c   -       gga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1910: 62759-62854 [+]
intergenic
Database links

Mature sequence sme-miR-9b-5p

Accession MIMAT0011247
Previous IDssme-miR-9b
Sequence

21 - 

ucuuugguuguuuagcuauauga

 - 43

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-9b-3p

Accession MIMAT0012145
Previous IDssme-miR-9b*
Sequence

54 - 

cauauacugcauaaucaaaguug

 - 76

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).