Stem-loop sequence sme-mir-1175

AccessionMI0010789 (change log)
DescriptionSchmidtea mediterranea miR-1175 stem-loop
Literature search

1 open access papers mention sme-mir-1175
(1 sentences)

Stem-loop
   --uauu           aug   -    au      a       -    aa 
5'       aaaauucuaaa   agu ggag  guugaa uucaaaa aaau  u
         |||||||||||   ||| ||||  |||||| ||||||| ||||   
3'       uuuuaggguuu   uca ccuc  caacuu gaguuuu uuug  u
   ucaaac           -aa   u    cu      a       a    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig3917: 32832-32930 [+]
intergenic
Database links

Mature sequence sme-miR-1175-5p

Accession MIMAT0012147
Previous IDssme-miR-1175
Sequence

18 - 

gaguggagauguugaaauucaaa

 - 40

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-1175-3p

Accession MIMAT0011249
Previous IDssme-miR-1175*
Sequence

60 - 

ugagauucaacuccuccuacu

 - 80

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).