Stem-loop sequence sme-mir-2157

AccessionMI0010790 (change log)
DescriptionSchmidtea mediterranea miR-2157 stem-loop
Stem-loop
   ------   a   u  agucaaau        uug          c  -  g 
5'       uua agg gc        uuugagua   caucaagaac ga au u
         ||| ||| ||        ||||||||   |||||||||| || ||  
3'       aau ucc cg        aaauucau   guaguuuuug cu ua u
   uucucu   c   u  ----aauu        uaa          a  a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig23847: 7335-7429 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-2157
sme-mir-216Contig23847: 7596-7698 [-]
sme-mir-2157Contig23847: 7335-7429 [-]
Database links

Mature sequence sme-miR-2157-5p

Accession MIMAT0011250
Previous IDssme-miR-2157
Sequence

21 - 

ugaguauugcaucaagaaccga

 - 42

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2157-3p

Accession MIMAT0012148
Previous IDssme-miR-2157*
Sequence

53 - 

caguuuuugaugaauuacuuaa

 - 74

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).