Stem-loop sequence sme-mir-2158

AccessionMI0010791 (change log)
DescriptionSchmidtea mediterranea miR-2158 stem-loop
Stem-loop
   -  aa     u   -aau    ug         u   a       c  a   u 
5'  gg  aguaa uuu    auuu  aguauuuuu cgu uaccgaa ag uca c
    ||  ||||| |||    ||||  ||||||||| ||| ||||||| || |||  
3'  cu  uuauu aaa    uaag  ucauaagaa gca auggcuu uc agu g
   g  gc     u   gagu    gu         -   -       -  -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1616: 21867-21968 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-2158
sme-mir-747Contig1616: 21999-22090 [-]
sme-mir-2158Contig1616: 21867-21968 [-]
Database links

Mature sequence sme-miR-2158-5p

Accession MIMAT0011251
Sequence

21 - 

ugaguauuuuuucguauaccga

 - 42

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2158-3p

Accession MIMAT0012149
Sequence

61 - 

ucgguaacgaagaauacuugga

 - 82

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).