Stem-loop sequence sme-mir-7d

AccessionMI0010793 (change log)
DescriptionSchmidtea mediterranea miR-7d stem-loop
Literature search

1 open access papers mention sme-mir-7d
(1 sentences)

Stem-loop
   -----aaaa       aacaauc          u  u   uu       ugcga      a      a 
5'          acuauaa       cuuggaagac ag aau  uguugua     aauuuu ucagac u
            |||||||       |||||||||| || |||  |||||||     |||||| |||||| u
3'          ugauauu       gaaccuuuug uc uua  acaacau     uuagga aguuug c
   gcaacuaac       ---caaa          -  u   uu       -----      g      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig17271: 6045-6169 [+]
intergenic
Database links

Mature sequence sme-miR-7d-5p

Accession MIMAT0011253
Previous IDssme-miR-7d
Sequence

21 - 

uggaagacuaguaauuuuguugu

 - 43

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-7d-3p

Accession MIMAT0012151
Previous IDssme-miR-7d*
Sequence

83 - 

caacauuauuucuguuuuccaa

 - 104

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).