![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sme-mir-2161 |
|||||
Accession | MI0010795 (change log) | ||||
Description | Schmidtea mediterranea miR-2161 stem-loop | ||||
Stem-loop |
--uuuuccu u a a u cuu u 5' uug cugua u guaucuuu uuauuacguacaaaaug gc u ||| ||||| | |||||||| ||||||||||||||||| || 3' aac gauau a uauggaga aaugaugcguguuuuac ug a cugcuauuu u a c u agu g |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sme-miR-2161-5p |
|
Accession | MIMAT0012152 |
Previous IDs | sme-miR-2161* |
Sequence |
20 - guaucuuuuuuauuacguacaaa - 42 |
Evidence | experimental; Illumina [1-2] |
Mature sequence sme-miR-2161-3p |
|
Accession | MIMAT0011255 |
Previous IDs | sme-miR-2161 |
Sequence |
65 - ugugcguaguaauagagguauc - 86 |
Evidence | experimental; 454 [1], Illumina [1-2] |
References |
|
1 |
PMID:19564616
"High-resolution profiling and discovery of planarian small RNAs"
Proc Natl Acad Sci U S A. 106:11546-11551(2009).
|
2 |
PMID:19553344
"Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea"
RNA. 15:1483-1491(2009).
|