Stem-loop sequence sme-mir-2161

AccessionMI0010795 (change log)
DescriptionSchmidtea mediterranea miR-2161 stem-loop
Stem-loop
   --uuuuccu   u     a a        u                 cuu  u 
5'          uug cugua u guaucuuu uuauuacguacaaaaug   gc u
            ||| ||||| | |||||||| |||||||||||||||||   ||  
3'          aac gauau a uauggaga aaugaugcguguuuuac   ug a
   cugcuauuu   u     a c        u                 agu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig33: 107534-107639 [+]
intergenic
Database links

Mature sequence sme-miR-2161-5p

Accession MIMAT0012152
Previous IDssme-miR-2161*
Sequence

20 - 

guaucuuuuuuauuacguacaaa

 - 42

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence sme-miR-2161-3p

Accession MIMAT0011255
Previous IDssme-miR-2161
Sequence

65 - 

ugugcguaguaauagagguauc

 - 86

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).