Stem-loop sequence sme-mir-2162

AccessionMI0010796 (change log)
DescriptionSchmidtea mediterranea miR-2162 stem-loop
Stem-loop
   ---  gcgu  u  a    -gu      cu          u    -cu u 
5'    ug    ag cu uggu   auugug  uauuuguaua ugca   g u
      ||    || || ||||   ||||||  |||||||||| ||||   | a
3'    ac    uc ga acca   uaacac  auaaacguau augu   c a
   ccu  aaau  -  -    guu      uu          u    uuu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig946: 66414-66509 [-]
intergenic
Database links

Mature sequence sme-miR-2162-5p

Accession MIMAT0011256
Sequence

21 - 

ugugcuuauuuguauauugc

 - 40

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2162-3p

Accession MIMAT0012153
Sequence

55 - 

guauuaugcaaauauucacaau

 - 76

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).