Stem-loop sequence sme-mir-2163

AccessionMI0010797 (change log)
DescriptionSchmidtea mediterranea miR-2163 stem-loop
Stem-loop
   auu    --  uu       -ca             a      uca       uug 
5'    acga  ga  uuauuuu   uaacuugauagau uaugca   acgagau   c
      ||||  ||  |||||||   ||||||||||||| ||||||   |||||||    
3'    ugcu  uu  aguaaag   guugaauuaucug auacgu   uguuuua   u
   -ac    aa  uu       cug             -      ---       uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig21390: 5654-5759 [+]
intergenic
Database links

Mature sequence sme-miR-2163-5p

Accession MIMAT0012154
Sequence

21 - 

uaacuugauagauauaugcauc

 - 42

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2163-3p

Accession MIMAT0011257
Sequence

65 - 

uugcauagucuauuaaguuggu

 - 86

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).