Stem-loop sequence sme-mir-133a

AccessionMI0010799 (change log)
DescriptionSchmidtea mediterranea miR-133a stem-loop
Stem-loop
   ---aaucgca       u          -      aa u      a     aaaug 
5'           guauauu auagcagcug uugacg  g aucaaa uaguu     a
             ||||||| |||||||||| ||||||  | |||||| |||||     u
3'           cauguaa uauugucgac aacugc  c ugguuu auuaa     g
   ccuacaauua       -          c      cc -      -     auaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig7719: 22250-22357 [+]
intergenic
Database links

Mature sequence sme-miR-133a-5p

Accession MIMAT0012155
Previous IDssme-miR-133a*
Sequence

20 - 

cagcuguugacgaaguaucaaaa

 - 42

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence sme-miR-133a-3p

Accession MIMAT0011258
Previous IDssme-miR-133a
Sequence

67 - 

uugguccccgucaaccagcugu

 - 88

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).