Stem-loop sequence sme-mir-96b

AccessionMI0010817 (change log)
DescriptionSchmidtea mediterranea miR-96b stem-loop
Literature search

1 open access papers mention sme-mir-96b
(1 sentences)

Stem-loop
   ---uaucaaa     g     aauuu        a     c     -ca   g 
5'           caguu ucuga     ggcacuua ggaau gucac   guu c
             ||||| |||||     |||||||| ||||| |||||   ||| a
3'           guuag agacu     cugugaau cuuua cagug   uag u
   ucuacuauug     -     auuau        -     -     uua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig4508: 34953-35054 [-]
intergenic
Database links

Mature sequence sme-miR-96b-5p

Accession MIMAT0011273
Previous IDssme-miR-96b
Sequence

21 - 

uuuggcacuuaaggaaucgucac

 - 43

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-96b-3p

Accession MIMAT0012163
Previous IDssme-miR-96b*
Sequence

62 - 

gacauuucuaagugucuauuau

 - 83

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).