Stem-loop sequence sme-mir-2177

AccessionMI0010825 (change log)
DescriptionSchmidtea mediterranea miR-2177 stem-loop
Stem-loop
   --aaa   c    ca   ga   -a             u  a      g 
5'      aau auug  cau  uac  agaaauucauugg ua uuucau a
        ||| ||||  |||  |||  ||||||||||||| || ||||||  
3'      uua uaac  gua  aug  ucuuuaagugacc gu aaagua u
   uuuac   u    aa   -g   gc             c  a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig12516: 6806-6901 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-2177
sme-mir-2148Contig12516: 6907-7002 [-]
sme-mir-2177Contig12516: 6806-6901 [-]
Database links

Mature sequence sme-miR-2177-5p

Accession MIMAT0012165
Sequence

21 - 

caagaaauucauugguuaauuuc

 - 43

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence sme-miR-2177-3p

Accession MIMAT0011279
Sequence

54 - 

aaaugcccagugaauuucucggu

 - 76

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).