Stem-loop sequence sme-mir-2179

AccessionMI0010827 (change log)
DescriptionSchmidtea mediterranea miR-2179 stem-loop
Stem-loop
   --caua  -a      uu     u        a      uuuaa       c 
5'       cu  agucua  uguau gcaaaaau uuuaua     cucauuu u
         ||  ||||||  ||||| |||||||| ||||||     |||||||  
3'       ga  ucggau  acgua cguuuuua agauau     gaguaaa c
   acugcc  gg      -u     u        g      ---ca       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig16538: 4036-4134 [-]
intergenic
Database links

Mature sequence sme-miR-2179-5p

Accession MIMAT0012166
Previous IDssme-miR-2179*
Sequence

20 - 

uugcaaaaauauuuauauuuaacuca

 - 45

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2179-3p

Accession MIMAT0011281
Previous IDssme-miR-2179
Sequence

58 - 

agacuauagagauuuuugcuau

 - 79

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).