Stem-loop sequence mtr-MIR2118

AccessionMI0010858 (change log)
DescriptionMedicago truncatula miR2118 stem-loop
Gene family MIPF0000745; MIR2118
Literature search

4 open access papers mention mtr-MIR2118
(12 sentences)

Stem-loop
   --a     a  a  -        u aaa    uu        u      u     a   -       aacagaucuaauucau 
5'    gagag ga ag ggaaaggg g   gagc  gaggaagu auggga auggg gga ucgguaa                c
      ||||| || || |||||||| |   ||||  |||||||| |||||| ||||| ||| |||||||                 
3'    cucuc cu uc ccuuucuc c   cuug  uuccuuua uauccu uaccc ccu agccauu                u
   uac     -  c  a        u ---    uu        u      -     a   u       ucuuuaauaaguuaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC235678.1: 74374-74532 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2118
mtr-MIR2118AC235678.1: 74374-74532 [-]
mtr-MIR482AC235678.1: 65790-65893 [+]
Database links

Mature sequence mtr-miR2118

Accession MIMAT0011318
Sequence

98 - 

uuaccgauuccacccauuccua

 - 119

Get sequence
Evidence experimental; 454 [1], Northern [1]

References

1
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).