Stem-loop sequence sbi-MIR166h

AccessionMI0010867 (change log)
DescriptionSorghum bicolor miR166h stem-loop
Gene family MIPF0000004; MIR166
Literature search

5 open access papers mention sbi-MIR166h
(11 sentences)

Stem-loop
   --a        uu      cu    gg gc      u    uccg    u       -         cucucuccccuagucuucgcgcgcuucc 
5'    ggggaaug  gucugg  cggg  c  cgccgc ccgc    cucc uccuucu cuggucucu                            u
      ||||||||  ||||||  ||||  |  |||||| ||||    |||| ||||||| |||||||||                            c
3'    ccccuuac  cggacc  gcuc  g  guggug ggcg    gagg aggagga gaccagagg                            a
   acc        uu      ag    ua au      -    ----    c       c         uucucuuccuccuucucugcuaccucua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr10: 60095470-60095654 [-]
intergenic
Database links

Mature sequence sbi-miR166h

Accession MIMAT0011327
Sequence

162 - 

ucggaccaggcuucauuccc

 - 181

Get sequence
Evidence by similarity; MI0001480

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).