Stem-loop sequence sbi-MIR166i

AccessionMI0010868 (change log)
DescriptionSorghum bicolor miR166i stem-loop
Gene family MIPF0000004; MIR166
Literature search

5 open access papers mention sbi-MIR166i
(11 sentences)

Stem-loop
   --      uc      - g     ccggccggacagucggccgg 
5'   ggaaug  gucugg c cgaga                    c
     ||||||  |||||| | |||||                     
3'   ccuuac  cggacc g gcucu                    g
   cc      uu      a -     ggcaggcuaggucuccugcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 26881126-26881211 [+]
intergenic
Database links

Mature sequence sbi-miR166i

Accession MIMAT0011328
Sequence

66 - 

ucggaccaggcuucauuccc

 - 85

Get sequence
Evidence by similarity; MI0001485

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).