Stem-loop sequence sbi-MIR166j

AccessionMI0010869 (change log)
DescriptionSorghum bicolor miR166j stem-loop
Gene family MIPF0000004; MIR166
Literature search

5 open access papers mention sbi-MIR166j
(12 sentences)

Stem-loop
   --ugu      uu         u   -   cucucuacau       ugga        c 
5'      ggaaug  gucugguuc agg ccu          gcaagca    uguaguag a
        ||||||  ||||||||| ||| |||          |||||||    ||||||||  
3'      ccuuac  cggaccagg ucc ggg          cguucgu    acgucauc g
   acucc      uu         c   a   ---------u       --ua        c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 79739088-79739195 [-]
intergenic
Database links

Mature sequence sbi-miR166j

Accession MIMAT0011329
Sequence

85 - 

ucggaccaggcuucauuccc

 - 104

Get sequence
Evidence by similarity; MI0001157

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).