Stem-loop sequence sbi-MIR166k

AccessionMI0010870 (change log)
DescriptionSorghum bicolor miR166k stem-loop
Gene family MIPF0000004; MIR166
Literature search

5 open access papers mention sbi-MIR166k
(11 sentences)

Stem-loop
   ---        g   a   a         uc   u     -     u    uu 
5'    gaauggag cug ucc agauccucc  gag gcgaa acaaa gccg  u
      |||||||| ||| ||| |||||||||  ||| ||||| ||||| ||||   
3'    cuuacuuc gac agg ucugggggg  cuc cguuu uguuu uggu  u
   cuc        g   c   c         uu   u     g     -    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr8: 46919923-46920025 [+]
intergenic
Database links

Mature sequence sbi-miR166k

Accession MIMAT0011330
Sequence

83 - 

ucggaccaggcuucauuccu

 - 102

Get sequence
Evidence by similarity; MI0001142

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).