Stem-loop sbi-MIR166k

Accession

MI0010870

Description

Sorghum bicolor sbi-MIR166k precursor miRNA

Gene family

MIPF0000004; MIR166

Literature search

5 open access papers mention sbi-MIR166k
(11 sentences)

Sequence

gaauggaggcugauccaagauccuccucgagugcgaaacaaaugccguuuuuuugguuuuguguuugcucucuuggggggucUCGGACCAGGCUUCAUUCCUc
((((((((.(((.(((.(((((((((..(((.((((((((((.((((......))))))))).))))).)))..))))))))).))).))).))))))))...

Structure

---        g   a   a         uc   u     -     u    uu 
   gaauggag cug ucc agauccucc  gag gcgaa acaaa gccg  u
   |||||||| ||| ||| |||||||||  ||| ||||| ||||| ||||   
   CUUACUUC GAC AGG Ucugggggg  cuc cguuu uguuu uggu  u
cUC        G   C   C         uu   u     g     -    uu 

Annotation confidence Not enough data

Genome context

chr8: 46919923-46920025 [+]

Mature sbi-miR166k

• Accession: MIMAT0011330
• Description: Sorghum bicolor sbi-miR166k mature miRNA
• Sequence: 83 - UCGGACCAGGCUUCAUUCCU - 102
• Evidence: not_experimental

References

1. PubMed ID: 19189423
   The Sorghum bicolor genome and the diversification of grasses
   "Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare"
   "Nature (2009) 457:551-556